Escherichia coli chromosomal map representing the terminus region

E.coli chromosome:

TerA TTTAGTTACAACATACTAATT

TerB T----------------TATT

TerC A-----------C----ATAT

TerD T----------------AATG

TerE C----------------TTAA

TerF CG-C------------GAAGG

The locations of the six terminus sites, replication origin (oriC ) and the tus gene. The symbols on the outer ring denotes the DNA-replication-terminus (Ter ) sequence that blocks the replication fork approaching from the side towards the cut out arrowhead.

Comparison of theTer sequences of E.coli . These sites arrest replication forks approaching from the 3'side (right).