|
|
E.coli chromosome: TerA TTTAGTTACAACATACTAATT TerB T----------------TATT TerC A-----------C----ATAT TerD T----------------AATG TerE C----------------TTAA TerF CG-C------------GAAGG |
|
The locations of the six terminus sites, replication origin (oriC ) and the tus gene. The symbols on the outer ring denotes the DNA-replication-terminus (Ter ) sequence that blocks the replication fork approaching from the side towards the cut out arrowhead. |
Comparison of theTer sequences of E.coli . These sites arrest replication forks approaching from the 3'side (right). |