1. Find the structure of trp repressor complexed with its operator from PDB. List the followingnformation : (1) ID number, (2) Authors, (3) Resolutions, (4) How many residues in one monomer, (5) How many cofactors in whole complex.Show the complex molecule on your homepages. Show different color for different chain in cartoon form. Indicate all the cofactors in spacefill form and blue color. Show the script that makes the final picture.

ID number: 1TRO

Author: Z.Otwinowski,R.G.Zhang,P.B.Sigler

Resolution: 1.9

Residues in one monomer: 108

cofactors in one complex: 4

2. Transcription of the ant gene during lytic growth of bacteriophage P22 is regulated by the cooperative binding of two Arc repressor dimers to a 21-base-pair operator site. Please find the co-crystal structure of this Arc tetramer-operator complex from PDB.

(a) Make an animation (by Gifbuilder) of whole complex.

(b) Show the DNA sequences of the Arc operator.

Chain E(cyan) TATAGTAGAGTGCTTCTATCAT

Chain F(purple) AATGATAGAAGCACTCTACTAT

(c) The picture below is the hydrogen bonds between beta-sheet side chains and DNA bases.Show three side chains (gln9, asn11, arg13) from one monomer and corresponding DNA bases of them on your home page. Color three side chain with different color. Measure the distance between possible hydrogen bonds.

Chain C

Chain D